Huntington's disease! EXTREME biology help please!

12. Below is the coding strand sequence of the first 300 bases in the normal HTT allele
(bottom rows) and the amino acids encoded by this sequence (top rows). Edit them to show the sequences of the disease version of the HTT allele and protein. (4 pts)

MetAlaThrLeuGluLysLeuMetLysAlaPheGluSerLeuLysSerPheGlnGlnGln
5’ atggcgaccctggaaaagctgatgaaggccttcgagtccctcaagtccttccagcagcag

GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln
cagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcaacag

ProProProProProProProProProProProGlnLeuProGlnProProProGlnAla
ccgccaccgccgccgccgccgccgccgcctcctcagcttcctcagccgccgccgcaggca

GlnProLeuLeuProGlnProGlnProProProProProProProProProProGlyPro
Cagccgctgctgcctcagccgcagccgcccccgccgccgcccccgccgccacccggcccg

AlaValAlaGluGluProLeuHisArgProLysLysGluLeuSerAlaThrLysLysGlu
gctgtggctgaggagccgctgcaccgaccaaagaaagaactttcagctaccaagaaagac
jlm10m
Asked Jul 22, 2011
You see the long chain of "cag" - Tripletts beginning in the end of the first line and ending at the end of the second.
In a normal version there are 9-36 of these "cag" - Tripletts in a row.
In the disease version there are 37-250 of these "cag" - Tripletts.

Heinrich
Answered Jul 22, 2011

TIP: If it's not your answer to this question, please click "Leave a Comment" button under the question to communicate with the question owner.

Categories